ENGLISHHOMECONTACT USSITEMAP

제품정보
Kyongshin PRODUCT

Zymo Research

Bertin

Saphymo (Bertin)

Berthold

Serumwerk

Biocomp

Capitalbio

Arrayjet

PolyAn

Hudson Robotics

ABER instrument

Arthus Biosystems

BioChain

Povair

BIOREAGENT(Bertin)

Zymo Research
▪ HOME>제품정보>Zymo Research
Quick-ITS Plus NGS Library Prep Kit (UDI)
Highlights

▶ The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.

▶ 100% automation ready with only a single PCR step and without the need for normalization.

▶ Real-time PCR enables absolute microbial copy number quantification.

서한형 대리

Zymo Research 제품 담당자

경신과학(주)

영업부

H.P) 010-8832-6303

HanHyung Seo

Zymo Research Brand Manager

Kyongshin scientific Co., Ltd.

Sales Department

H.P) 82)10-8832-6303

제품소개


Product Description


The Quick-ITS Plus NGS Library Prep Kit (UDI) is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing, now with unique dual indexing for improved barcode resolution. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.

Technical Specifications

Sample InputPurified microbial DNA ≤100 ng, free of PCR inhibitors.
ITS Primer Sequences (adapters not shown)ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp).
Index PrimersDual index (barcodes) to uniquely label samples.
Barcode Sequences10 bp barcodes, Available for download here (USA Only), or by visiting the Documentation section of the D6425 Product Page at www.zymoresearch.com.
Amplicon SizeThe final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp.
Sequencing PlatformIllumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F.
Required EquipmentMicrocentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates.






주문정보

CAT.No 품명 규격 비고
D6425-PS1 Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 1 96 rxns
D6425-PS2 Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 2 96 rxns
D6425-PS3 Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 3 96 rxns
D6425-PS4 Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 4 96 rxns